TweetFollow Us on Twitter

Oct 96 Challenge
Volume Number:12
Issue Number:10
Column Tag:Programmer’s Challenge

Programmer’s Challenge

By Bob Boonstra

Note: Source code files accompanying article are located on MacTech CD-ROM or source code disks.

DNA Match

This month’s Challenge is based on a suggestion submitted by Vicente Giles of the Universidad de Málaga. Vincente faces a real-world problem to look for all the genomic sequences that match certain

criteria, given a DNA database sequence and a problem sequence. A DNA sequence is a string of the four different nucleotides involved in the genetic code, denoted ‘A’, ‘C’, ‘G’, and ‘U’, which stand for adenine, cytosine, guanine, and uracil. The problem is to find all possible matches of the problem sequence in the database sequence, allowing a specified number of differences.

The prototype for the code you should write is:

long FindMatch(
 char *alphabet, /* legal characters for database and fragment strings */
 char *database, /* reference string to compare fragments against */
 void *storage,  /* storage preallocated for your use */
 char *fragment, /* string to match against database */
 long diffsAllowed,/* differences allowed between fragment and database */
 long matchPosition[]/* return match positions in this array*/
);

void InitMatch(
 char *alphabet, /* legal characters for database and fragment strings */
 char *database, /* reference string to compare fragments against */
 void *storage   /* storage preallocated for your use */
);

Because we would like our DNA-matching algorithm to be useful even if scientists discover an extraterrestrial genetic code based on other nucleotides, the algorithm accepts the genetic alphabet as a parameter. In the problem posed by Vincente, this would be the string “ACGU”, but in our Challenge it might include any of the characters ‘a’..’z’ or ‘A’..’Z’ (Extraterrestrial DNA is case sensitive). The null-terminated reference string contained in the database parameter can be up to 1000000000 (109) characters long. The fragment that you are to match is also null-terminated, but will be significantly shorter on average (up to 10000 characters) than the database string. You should compare the input fragment against database, finding all occurrences of fragment that differ in no more than diffsAllowed positions from a substring of database. Your code should populate one entry in the preallocated matchPosition array for each match found, storing the offset of the character in database that corresponds to the first character of fragment. The FindMatch function should return the number of matches found.

As an example, given the following input

alphabet: ACGU

database: ACGTACGTACGTAAAAAATACGTACGTATA

fragment: ACGTACGTAC

diffsAllowed: 5

your code should find 7 matches and store the following values in matchPosition:

-4 0 4 8 15 19 23


Notice that partial matches can occur at the beginning or the end of database, and as a result, the offsets returned in matchPosition can be negative or greater than strlen(database) - strlen(fragment).

To allow you to do some preprocessing, your InitMatch routine will be called once before a sequence of calls to FindMatch. InitMatch will be called with the same alphabet and database parameters provided to subsequent FindMatch calls. Both routines will also be given the same storage parameter that points to at least 1MB of memory allocated and initialized to zero by the calling routine. FindMatch will be called between 100 and 1000 times, on average, for each call to InitMatch. The winning solution will be the one with the fastest execution time, including the execution time for both InitMatch and FindMatch.

Other fine print: The alphabet characters will be provided in increasing ASCII order. The offsets you store in matchPosition need not be in any particular order. The value for diffsAllowed will typically be smaller than 50% of strlen(fragment). Finally, you should not allocate any dynamic storage in your solution beyond that provided in the storage parameter.

This will be a native PowerPC Challenge using the latest Symantec environment. Solutions may be coded in C or C++.

Two Months Ago Winner

Congratulations to Randy Boring for submitting the fastest entry to the A-Maze-ing Programmer’s Challenge. The Challenge this month was to write code that would find a path leading out of a three-dimensional maze. The solutions were provided with the maze size, an initial position, some storage for use in mapping the maze, and a callback routine. The callback provided the result of attempting to move in a given direction, indicating whether the attempt to move succeeded, failed because there was no opening in the specified direction, resulted in a fall down a shaft in the mine, or found an exit to the mine. Of the four entries submitted, only two successfully solved all of my test mazes; one of the entries crashed, and one went into an infinite loop.

The table below summarizes the results for each correct entry, including the language in which the solution was written, the size of the solution code, the amount of static data used by the solution, the total execution time for all test cases, and the number of moves needed to solve the mazes.

Name Language Code Size Data Size Time Moves

Randy Boring C++ 2792 484 343153 33519

Jay Negro C++ 1788 51 40945114 7120802

The test mazes used in the evaluation ranged in size from 10x20x30 to 100x100x200, and ranged in density (the percentage of open cells) from 10% to 20%. As indicated in the problem statement, a path to an exit was guaranteed to exist from any cell reachable from the starting position.

Randy’s winning entry spent more time processing each move than the second place entry from first-time Challenge contestant Jay Negro, but Randy’s code solved the maze using significantly fewer moves and executed two orders of magnitude more quickly. His code maintains a queue of what are believed to be the best moves to try. As long as there are moves in the best move list, it invokes the callback with the best move, checks for success, and then updates the map with what it has learned about the maze position it just tried. The CalcBestMove routine determines the best possible move (surprise!) by first moving toward an adjacent maze boundary if one exists, or moving toward the nearest maze boundary if nothing is known about the current position, or trying adjacent positions about which nothing is known, or finally by moving toward a position about which nothing is known. The CalcBestMove heuristics, along with judicious use of inline functions and some optimization of maze offset calculations, combined to make this an efficient solution.

Careful readers of the code will note one potential problem with the Initialize routine, in that it simply gives up and returns if it is unable to allocate enough memory. This could have caused the winning entry to fail for larger mazes when given only the amount of memory guaranteed by the problem. However, the size of the mazes that I could practically evaluate was limited by the speed of the other entries, and the memory problem did not show up with those cases, so I elected to ignore it. Under other circumstances, proper handling of low memory conditions would have been required to win.

TOP 20 CONTESTANTS

Here are the Top 20 Contestants for the Programmer’s Challenge. The numbers below include points awarded over the 24 most recent contests, including points earned by this month’s entrants.

RankNamePoints
1.Munter, Ernst193
2.Gregg, Xan92
3.Larsson, Gustav87
4.[Name deleted]60
5.Lengyel, Eric40
6.Lewis, Peter30
7.Boring, Randy27
8.Beith, Gary24
9.Kasparian, Raffi22
10.Vineyard, Jeremy22
11.Cutts, Kevin21
12.Picao, Miguel Cruz21
13.Brown, Jorg20
14.Gundrum, Eric20
15.Karsh, Bill19
16.Stenger, Allen19
17.Cooper, Greg17
18.Mallett, Jeff17
19.Nevard, John17
20.Nicolle, Ludovic14

There are three ways to earn points: (1) scoring in the top 5 of any Challenge, (2) being the first person to find a bug in a published winning solution or, (3) being the first person to suggest a Challenge that I use. The points you can win are:

1st place20 points
2nd place10 points
3rd place7 points
4th place4 points
5th place2 points
finding bug2 points
suggesting Challenge2 points

Here is Randy’s winning solution:

Amazing.cp

Copyright © 1996 Randy Boring

typedef Boolean (*MoveProc) (
 long xMove,long yMove,long zMove,
 long *newXPos,long *newYPos,long *newZPos
 );

// the MoveProc, MakeAMove, is a callback.  It returns true if you 
// have found your way out of the maze.
// You give it (x,y,z) as a delta from your current position,
// each from [-1, 0, 1].  Straight up and straight down (and all zeroes)
// always result in no movement. 

Boolean Maze (long xMove, // these are your initial position
 long yMove,
 long zMove,
 long xSize,// these are the dimensions of the maze
 long ySize,
 long zSize,
 MoveProc MakeAMove, // this is your callback routine
 char *mapStorage// this is your preallocated storage
 );// (one char per position in maze)

Typedefs and Constants
typedef long dirT; // direction enumerator (0-24)

static
const long dir2dx[25]={9,
 -1, 0, 1,  -1, 1,  -1, 0, 1,
 -1, 0, 1,  -1, 1,  -1, 0, 1,
 -1, 0, 1,  -1, 1,  -1, 0, 1,};
static
const long dir2dy[25]={9, 
 1, 1, 1,   0, 0,  -1,-1,-1,
  1, 1, 1,   0, 0,  -1,-1,-1,
  1, 1, 1,   0, 0,  -1,-1,-1,};
static
const long dir2dz[25]={9,
  1, 1, 1,   1, 1,   1, 1, 1,
  0, 0, 0,   0, 0,   0, 0, 0,
 -1,-1,-1,  -1,-1,  -1,-1,-1,};
static
const dirT di[3][3][3] = {
  {{1,2,3},{4,0,5},{6,7,8}},
  {{9,10,11},{12,0,13},{14,15,16}},
  {{17,18,19},{20,0,21},{22,23,24}}};
static const dirT kNoDir = 0;
static const dirT kFirstDir = 1;
static const dirT kLastDir = 24;
static const dirT kNumDirs = 25; // including kNoDir at zero
static const char kUnknown = 0;  // unknown square
    // every type below is known
static const char kWall = 1;// wall
static const char kSpace = 2; // space-above-wall
static const char kFall = 4;// space-above-space
static const char kTriedSpace = 10;// searched space
static const char kTriedFall = 12; // searched fall

static const short kTakeProb = 4;  // 1/4th
static const long kSTNBlockSize = 48;

typedef long squareIndexT;
typedef struct STN {
 struct STN *parent;
 squareIndexT square;// square index of this node
 dirT   direction; // how I got here from my parent
 } SearchTreeNode, *STNPtr, **STNHandle;

Globals
static STNPtr gTreeRoot;
static STNPtr gTreeTop;
static STNPtr gQHead;
static STNPtr gQTail;
static STNPtr gBestMoveList;
static STNHandle gTreeRootH;
static STNHandle gBestMoveListH;
static STNPtr gBestMoveListNextPos;

Defines 
#define myIsUnknown(sq) (kUnknown == (sq))
#define myIsKnown(sq)(kUnknown != (sq))
    // the below should only be used when the square is known
#define myIsWall(sq) (kWall == (sq))
#define myIsUntriedWalkable(sq)  (kSpace == (sq))
#define myIsOpen(sq) (0x00 == (0x01 & (sq)))
#define myIsWalkable(sq) (0x02 == (0x02 & (sq)))
#define myIsUntriedFall(sq) (kFall == (sq))
#define myIsFall(sq) (0x04 == (0x04 & (sq)))
#define myIsTried(sq)(0x08 == (0x08 & (sq)))
#define d2x(d) (dir2dx[d])
#define d2y(d) (dir2dy[d])
#define d2z(d) (dir2dz[d])
#define xvec(d) (d2x(d))
#define yvec(d,xN) (d2y(d) * (xN))
#define zvec(d,xyN) (d2z(d) * (xyN))
#define offsetD(d,xN,xyN) (xvec(d) + yvec(d,xN) + zvec(d,xyN))
#define offsetXYZ(x,y,z,xN,xyN) ((x) + (y) * xN + (z) * (xyN))
#define map(m,x,y,z,xN,xyN) (*(m + (x) + (y) * xN + (z) * (xyN)))

#ifdef powerc
#define BreakToSourceDebugger_()   Debugger()
#else   // 68K
#define BreakToSourceDebugger_()   SysBreak()
#endif  // powerc


isEmptySearchQ
static inline Boolean
isEmptySearchQ() {return (gQHead == gQTail);}

isFullSearchQ
static inline Boolean
isFullSearchQ() {return (gTreeTop <= gQTail);}

DeQ
static inline STNPtr
DeQ(void) {return gQHead++;}

EnQ
static inline STNPtr
EnQ(void) {
 STNPtr p = gQTail++;
    //if (isFullSearchQ())
    //    BreakToSourceDebugger_();
 return (p);
}

EnQNewCandidate
// Add this move (direction to a square index) to the tree at the current node, assumes 
// the square index has not already been visited by this search.
static void
EnQNewCandidate(STNPtr parent, const long sqi, 
 const dirT d)
{
STNPtr newNode = EnQ();
newNode->parent = parent;
newNode->direction = d;
newNode->square = sqi;
}

isEmptySearchTree
static inline Boolean
isEmptySearchTree() {return (gTreeRoot == gQTail);}

PopSearchTree
static inline long
PopSearchTree(void) {return ((-gQTail)->square);}

NewSearchTree
static void
NewSearchTree(void) {
 gQTail = gQHead = gTreeRoot;
 gQTail++;// the only time we’re called,
}//  gTreeRoot is immediately the EnQed elem.

DisposeSearchTree
static void
DisposeSearchTree(char *m) {
while (!isEmptySearchTree()) {
    // remove ‘tried’ mark
 *(m + PopSearchTree()) = kSpace;
 }
}

isEmptyMoveList
static inline Boolean
isEmptyMoveList()
 {return (gBestMoveListNextPos == gBestMoveList);}

PushMoveList
static inline void
PushMoveList(const dirT d) {
 gBestMoveListNextPos->direction = d;
 gBestMoveListNextPos++;}

PopMoveList
static inline dirT
PopMoveList(void) {
 -gBestMoveListNextPos;
 return (gBestMoveListNextPos->direction);}

NewBestMoveList
static void
NewBestMoveList(void) {gBestMoveListNextPos = gBestMoveList;}

SetBestMove
// Copy the sequence of best directions-to-move to the
// best move list.  (The tree is about to be freed.)
static void
SetBestMove(STNPtr node, const dirT d)
{
PushMoveList(d);
while (kNoDir != node->direction) { // the root’s dir
 PushMoveList(node->direction);
 node = node->parent;
 }
}

Initialize
// Initialize everything for the routine
// map is already initialized to zeroes (kUnknown == 0)
static Boolean
Initialize(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
const long xySize = xSize * ySize;
long treeBytesWanted = sizeof(SearchTreeNode)
 * ((xSize - 2) * (ySize - 2) * (zSize - 2) + 4);
long treeBytesNeeded = sizeof(SearchTreeNode)
 * ((xSize - 2) + (ySize - 2) + (zSize - 2) + 1);
Boolean succeed = true;

map(m,x,y,z,xSize,xySize) = kSpace;
map(m,x,y,z-1,xSize,xySize) = kWall;

gBestMoveListH = (STNHandle) NewHandle(sizeof(SearchTreeNode)
 * (zSize + xySize) * 2);
if (!gBestMoveListH) succeed = false;
 // unable to initialize successfully,MEM
HLock((Handle) gBestMoveListH);
gBestMoveList = *gBestMoveListH;

do {
 gTreeRootH = (STNHandle) NewHandle(treeBytesWanted);
 treeBytesWanted *= 0.9;
 }
 while (!gTreeRootH && 
 (treeBytesNeeded <= treeBytesWanted));
if (!gTreeRootH) succeed = false;
 // unable to initialize successfully,MEM
HLock((Handle) gTreeRootH);
gTreeRoot = *gTreeRootH;

NewBestMoveList();
return succeed;
}


DeInitialize
// Free everything we allocated
static void
DeInitialize()
{
HUnlock((Handle) gBestMoveListH);
DisposeHandle((Handle) gBestMoveListH);
HUnlock((Handle) gTreeRootH);
DisposeHandle((Handle) gTreeRootH);
}


AtEdge
// Are we at an edge?
// return true if we are
static Boolean
AtEdge(const long x, const long y, const long z,
 const long xMax, const long yMax, const long zMax)
{
if (0==x || 0==y || 0==z) return true;
if (xMax==x || yMax==y || zMax==z) return true;
return false;
}


MapMove
// Map the move we just made/tried.
// I.e., store our new knowledge of the maze in the map
static void
MapMove(const long oldx, const long oldy, const long oldz,
 const long newx, const long newy, const long newz,
 char *m, const long xN, const long xyN,
 const long dx, const long dy, const long dz)
{
long x = oldx + dx; // where we tried to move
long y = oldy + dy; // (we need these in either case below)
long z = oldz + dz;
long sqi = offsetXYZ(x, y, z, xN, xyN);
if (newx==oldx && newy==oldy && newz==oldz) { // bump!
    // mark as wall the square we bumped into
 *(m + sqi) = kWall;
    // lastTried was not successful
    //gLastWasSuccess = false;
 }
else {
    // mark as clear any squares we fell through
    // actually mark them with as fall because they can’t
    // really be moved ‘to’ only through, downwards.
 if (newz < z) {
 do {
 *(m + sqi) = kFall;
 z-;
 sqi -= xyN;
 } while (newz < z);
 }
    // mark as clear our current space
 *(m + sqi) = kSpace;
    // mark as ‘wall’ the square we are standing on
 sqi -= xyN;
 *(m + sqi) = kWall;
    // lastTried was successful
    //gLastWasSuccess = true;
    // direction of last success
    //gLastSuccess = lastTried;
 }
}


APossibleExit
// return a direction in which
// there may be an adjacent exit.
// A possible exit must be both an edge and untried.
static dirT
APossibleExit(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m, dirT lastTried)
{
dirT tryD = lastTried + 1; // start here
/* check for edge conditions first */
if (x > 1 && x < xSize - 2)
 if (y > 1 && y < ySize - 2)
 if (z > 1 && z < zSize - 2)
    /* no exits are possibly nearby */
    /* because no edges are nearby */
 return kNoDir; // zero

/* search the adjacent spaces for a possible exit */
/* this could improve a lot */
while (tryD <= kLastDir) {
 const long dx = d2x(tryD);
 const long dy = d2y(tryD);
 const long dz = d2z(tryD);
 if (AtEdge(x+dx, y+dy, z+dz, xSize-1, ySize-1, zSize-1))
 if (myIsUnknown(map(m, x + dx, y + dy, z + dz,
 xSize, xSize * ySize)))
 return tryD;
 tryD++;
 }
tryD = kFirstDir;
while (tryD <= lastTried) {
 const long dx = d2x(tryD);
 const long dy = d2y(tryD);
 const long dz = d2z(tryD);
 if (AtEdge(x+dx, y+dy, z+dz, xSize-1, ySize-1, zSize-1))
 if (myIsUnknown(map(m, x + dx, y + dy, z + dz,
 xSize, xSize * ySize)))
 return tryD;
 tryD++;
 }
return kNoDir; // zero, no possible exit found nearby
}


TotallyUnknown
// returns true if every move leads to an unknown square
// this is only possible at the beginning and after falling
// at least three below our last position.
static Boolean
TotallyUnknown(const long x, const long y, const long z,
 const long xSize, const long xySize, char *m)
{
dirT dir;
/* loop through the directions until we find a known spot */
for (dir = kFirstDir; dir <= kLastDir; dir++) {
 const long dx = d2x(dir);
 const long dy = d2y(dir);
 const long dz = d2z(dir);
 if (!myIsUnknown(map(m, x + dx, y + dy, z + dz,
 xSize, xySize)))
 return false;
 }
return true;
}


MoveTowardsNearWall
// Pick a move that is towards a near wall
// (NOTE: only used when all directions are unknown)
static dirT
MoveTowardsNearWall(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
#pragma unused (m)
long distx = xSize - x - 1; // distance from x==xMax edge
long disty = ySize - y - 1; // distance from y==yMax edge
long distz = zSize - z - 1; // distance from z==zMax edge
// [xyz] is distance from [xyz]==0 edge
long dx, dy, dz;
long xy = xSize * ySize;

if (x < distx) dx = -1;
else if (x == distx) dx = 0;
else dx = 1;
if (y < disty) dy = -1;
else if (y == disty) dy = 0;
else dy = 1;
if (z < distz) dz = -1;
else if (z == distz) dz = 0;
else dz = 1;

return di[dy+1][dz+1][dx+1];
}


Gravity
// Fall until we find a floor below us
// Only use after mapping new knowledge
// (Don’t use during mapping)
static long
Gravity(long i, const char *m, const long xySize)
{
do {i -= xySize;}
 while (kWall != *(m + i));
 
return i + xySize;
}


SearchOneSquare
// Search from this square for an adjacent unknown square
// queueing up moveable squares (including spaces below
// falls) for further research later,
// marking enqueued squares as ‘tried’ (immediately meaning
// ‘not-to-be-queued-for-trying’, later ‘actually-tried’)
// NOTE: while I could mark falls as tried (upward from
// every space) they are rather unlikely to be in the
// search path, so it’s not worth it.  Just re-enact
// gravity each time, and check last square for ‘tried’.
static Boolean
SearchOneSquare(STNPtr startSTN,
 const long xSize, const long xySize, char *m)
{
dirT d;
const long startSquare = startSTN->square;

for (d = kFirstDir; d <= kLastDir; d++) {
 const long sqi = startSquare + offsetD(d,xSize,xySize);
 const char sq = *(m + sqi);
 if (myIsUnknown(sq)) {
 SetBestMove(startSTN, d);
 return true;
 }
 else if (myIsUntriedWalkable(sq)) {
 EnQNewCandidate(startSTN,sqi,d);
 *(m + sqi) = kTriedSpace;
 }
 else if (myIsUntriedFall(sq)) {
 const long bottomSqi = Gravity(sqi,m,xySize);
 const long bottomSq = *(m + bottomSqi);
 if (myIsUntriedWalkable(sq)) {
 EnQNewCandidate(startSTN,bottomSqi,d);
 *(m + bottomSqi) = kTriedSpace;
 }
    //else if (myIsUnknown(bottomSq)) {
    //    BreakToSourceDebugger_(); // should be impossible
    //    return true; //??
    //    }
 else ; //it’s an already tried space, do nothing
 }
 else ; // it’s a wall or already tried space, do nothing
 }
return false;
}


FindNearestUnknown
// Find a move sequence that will lead to an unknown
// square (preferably an edge square?).
static dirT
FindNearestUnknown(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
#pragma unused (zSize)
const long xySize = xSize * ySize;
Boolean found = false;
// make new search tree with square at x,y,z
NewSearchTree();
NewBestMoveList();
gTreeRoot->parent = nil;
gTreeRoot->square = offsetXYZ(x,y,z,xSize,xySize);
gTreeRoot->direction = kNoDir;
*(m + gTreeRoot->square) = kTriedSpace;
// fan out from this one layer at a time
while (!isEmptySearchQ() && !found) {
 STNPtr tryNode = DeQ();
 found = SearchOneSquare(tryNode, xSize, xySize, m);
    //FreeSTN(tryNode);
 }
DisposeSearchTree(m);
// found move(list) or failed
return found;
}


CalcBestMove
// Calculate the best move to try
// return true if we have found an exit or are at wit’s end
static dirT
CalcBestMove(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
static dirT lastTried = kNoDir;
dirT d;

if (!isEmptyMoveList()) { // we have a pre-made list of moves

 

Community Search:
MacTech Search:

Software Updates via MacUpdate

Fantastical 2.5.13 - Create calendar eve...
Fantastical is the Mac calendar you'll actually enjoy using. Creating an event with Fantastical is quick, easy, and fun: Open Fantastical with a single click or keystroke Type in your event... Read more
A Better Finder Rename 11.05 - File, pho...
A Better Finder Rename is the most complete renaming solution available on the market today. That's why, since 1996, tens of thousands of hobbyists, professionals and businesses depend on A Better... Read more
SpamSieve 2.9.38 - Robust spam filter fo...
SpamSieve is a robust spam filter for major email clients that uses powerful Bayesian spam filtering. SpamSieve understands what your spam looks like in order to block it all, but also learns what... Read more
TeamViewer 15.0.8397 - Establish remote...
TeamViewer gives you remote control of any computer or Mac over the Internet within seconds or can be used for online meetings. Find out why more than 200 million users trust TeamViewer! Free for non... Read more
SteerMouse 5.4.3 - Powerful third-party...
SteerMouse is an advanced driver for USB and Bluetooth mice. SteerMouse can assign various functions to buttons that Apple's software does not allow, including double-clicks, modifier clicks,... Read more
Toast Titanium 18.2.1 - The ultimate med...
Roxio Toast Titanium, the leading DVD burner for Mac, makes burning even better, adding Roxio Secure Burn to protect your files on disc and USB in Mac- or Windows-compatible formats. Get more style... Read more
HoudahSpot 5.0.11 - Advanced file-search...
HoudahSpot is a versatile desktop search tool. Use HoudahSpot to locate hard-to-find files and keep frequently used files within reach. HoudahSpot will immediately feel familiar. It works just the... Read more
ClipGrab 3.8.6 - Download videos from Yo...
ClipGrab is a free downloader and converter for YouTube, Vimeo, Facebook and many other online video sites. It converts downloaded videos to MPEG4, MP3 or other formats in just one easy step Version... Read more
ExpanDrive 7.4.0 - Access cloud storage...
ExpanDrive builds cloud storage in every application, acts just like a USB drive plugged into your Mac. With ExpanDrive, you can securely access any remote file server directly from the Finder or... Read more
Adobe Dreamweaver CC 2020 20.0 - Build w...
Dreamweaver CC 2020 is available as part of Adobe Creative Cloud for as little as $20.99/month (or $9.99/month if you're a previous Dreamweaver customer). Adobe Dreamweaver CC 2020 allows you to... Read more

Latest Forum Discussions

See All

New heroes and balance updates set to ar...
It feels like Hearthstone: Battlegrounds only launched yesterday, and already the auto batter addition to Blizzard's megahit card game is set to receive new heroes and balance updates. [Read more] | Read more »
Pre-register for Hello Kitty AR: Kawaii...
Hello Kitty — the cute cat that launched a multi-billion-pound franchise — has been brought to life… sort of. Sanrio has teamed up with the Bublar Group to create a new mobile game that uses AR tech to turn the real world into Hello Kitty’s... | Read more »
Gorgeous and tranquil puzzler Spring Fal...
One-man indie studio SPARSE//GameDev has now launched its tranquil puzzler, Spring Falls. It's described as "a peaceful puzzle game about water, erosion, and watching things grow". [Read more] | Read more »
Black Desert Mobile gets an official rel...
Pearl Abyss has just announced that its highly-anticipated MMO, Black Desert Mobile, will launch globally for iOS and Android on December 11th. [Read more] | Read more »
Another Eden receives new a episode, cha...
Another Eden, WFS' popular RPG, has received another update that brings new story content to the game alongside a few new heroes to discover. [Read more] | Read more »
Overdox guide - Tips and tricks for begi...
Overdox is a clever battle royale that changes things up by adding MOBA mechanics and melee combat to the mix. This new hybrid game can be quite a bit to take in at first, so we’ve put together a list of tips to help you get a leg up on the... | Read more »
Roterra Extreme - Great Escape is a pers...
Roterra Extreme – Great Escape has been described by developers Dig-It Games as a mini-sequel to their acclaimed title Roterra: Flip the Fairytale. It continues that game's tradition of messing with which way is up, tasking you with solving... | Read more »
Hearthstone: Battlegrounds open beta lau...
Remember earlier this year when auto battlers were the latest hotness? We had Auto Chess, DOTA Underlords, Chess Rush, and more all gunning for our attention. They all had their own reasons to play, but, at least from where I'm standing, most... | Read more »
The House of Da Vinci 2 gets a new gamep...
The House of Da Vinci launched all the way back in 2017. Now, developer Blue Brain Games is gearing up to deliver a second dose of The Room-inspired puzzling. Some fresh details have now emerged, alongside the game's first official trailer. [Read... | Read more »
Shoot 'em up action awaits in Battl...
BattleBrew Productions has just introduced another entry into its award winning, barrelpunk inspired, BattleSky Brigade series. Whilst its previous title BattleSky Brigade TapTap provided fans with idle town building gameplay, this time the... | Read more »

Price Scanner via MacPrices.net

Apple continues to offer 2017 13″ Dual-Core n...
Apple has Certified Refurbished 2017 13″ 2.3GHz Dual-Core non-Touch Bar MacBook Pros still available starting at $1019. An standard Apple one-year warranty is included with each model, outer cases... Read more
Save up to $120 on the new 16″ MacBook Pro at...
Apple’s resellers are starting to receive stock of new 16″ MacBook Pros, and the first set of sales & deals are now available: (1) Amazon 16″ MacBook Pros start on sale for $100-$116 off Apple’s... Read more
Apple Watch Series 3 models on sale at Amazon...
Amazon has Apple Watch Series 3 GPS models on sale for $30 off MSRP, starting at only $169. There prices are the lowest we’ve ever seen for these models from any Apple reseller. Choose Amazon as the... Read more
The ‘Mac Potpourri’ Mailbag: Edition #1- Info...
COMMENTARY: 11.20.19- Welcome to the inaugural edition of the “Mac Potpourri” Mailbag where we take a look at correspondence received from readers of this column from all over the world who write in... Read more
13″ 2.4GHz MacBook Pros available for up to $...
Apple has a full line of Certified Refurbished 2019 13″ 2.4GHz 4-Core Touch Bar MacBook Pros available starting at $1529 and up to $300 off MSRP. Apple’s one-year warranty is included, shipping is... Read more
New at T-Mobile: Switch to T-Mobile, and get...
T-Mobile is offering a free 64GB iPhone 8 for new customers who switch to T-Mobile and open a new line of service. Eligible trade-in required, and discount applied over a 24 month period. The fine... Read more
Xfinity Mobile’s Black Friday Apple savings:...
Take $250 off the purchase of any iPhone at Xfinity Mobile with a new line activation, and transfer of phone number to Xfinity Mobile, through December 8, 2019. This includes Apple’s new iPhone 11... Read more
2019 13″ 1.4GHz MacBook Pros available starti...
Apple has a full line of Certified Refurbished 2019 13″ 1.4GHz 4-Core Touch Bar MacBook Pros available starting at $1099 and up to $230 off MSRP. Apple’s one-year warranty is included, shipping is... Read more
Save up to $350 on a 21″ or 27″ iMac with the...
Apple has Certified Refurbished 2019 21″ & 27″ iMacs available starting at $929 and up to $350 off the cost of new models. Apple’s one-year warranty is standard, shipping is free, and each iMac... Read more
Early Holiday 2019 Sale: B&H again offers...
B&H Photo has 10.2″ iPads on sale again for $30 off Apple’s MSRP, starting at $299, as part of their early Holiday 2019 sale. Overnight shipping is free to many addresses in the US: – 10.2″ 32GB... Read more

Jobs Board

Best Buy *Apple* Computing Master - Best Bu...
**745516BR** **Job Title:** Best Buy Apple Computing Master **Job Category:** Store Associates **Store NUmber or Department:** 001101-Manhattan-Store **Job Read more
Best Buy *Apple* Computing Master - Best Bu...
**746655BR** **Job Title:** Best Buy Apple Computing Master **Job Category:** Sales **Store NUmber or Department:** 002518-Atlantic Center-Store **Job Description:** Read more
*Apple* Mobility Pro - Best Buy (United Stat...
**747089BR** **Job Title:** Apple Mobility Pro **Job Category:** Store Associates **Store NUmber or Department:** 000377-Prescott AZ-Store **Job Description:** At Read more
*Apple* Health Benefit Specialist - Call Cen...
Description ** Apple Health Benefit Specialist - Call Center (MAS 3/MACSC)** **Olympia, WA Multiple Positions** *The ideal candidate for this position will have Read more
Hair Stylist - *Apple* Blossom Mall - JCPen...
Hair Stylist - Apple Blossom Mall Location:Winchester, VA, United States- Apple Blossom Mall 1850 Apple Blossom Dr Job ID:1065040Salon Professionals Job Read more
All contents are Copyright 1984-2011 by Xplain Corporation. All rights reserved. Theme designed by Icreon.