TweetFollow Us on Twitter

Oct 96 Challenge
Volume Number:12
Issue Number:10
Column Tag:Programmer’s Challenge

Programmer’s Challenge

By Bob Boonstra

Note: Source code files accompanying article are located on MacTech CD-ROM or source code disks.

DNA Match

This month’s Challenge is based on a suggestion submitted by Vicente Giles of the Universidad de Málaga. Vincente faces a real-world problem to look for all the genomic sequences that match certain

criteria, given a DNA database sequence and a problem sequence. A DNA sequence is a string of the four different nucleotides involved in the genetic code, denoted ‘A’, ‘C’, ‘G’, and ‘U’, which stand for adenine, cytosine, guanine, and uracil. The problem is to find all possible matches of the problem sequence in the database sequence, allowing a specified number of differences.

The prototype for the code you should write is:

long FindMatch(
 char *alphabet, /* legal characters for database and fragment strings */
 char *database, /* reference string to compare fragments against */
 void *storage,  /* storage preallocated for your use */
 char *fragment, /* string to match against database */
 long diffsAllowed,/* differences allowed between fragment and database */
 long matchPosition[]/* return match positions in this array*/
);

void InitMatch(
 char *alphabet, /* legal characters for database and fragment strings */
 char *database, /* reference string to compare fragments against */
 void *storage   /* storage preallocated for your use */
);

Because we would like our DNA-matching algorithm to be useful even if scientists discover an extraterrestrial genetic code based on other nucleotides, the algorithm accepts the genetic alphabet as a parameter. In the problem posed by Vincente, this would be the string “ACGU”, but in our Challenge it might include any of the characters ‘a’..’z’ or ‘A’..’Z’ (Extraterrestrial DNA is case sensitive). The null-terminated reference string contained in the database parameter can be up to 1000000000 (109) characters long. The fragment that you are to match is also null-terminated, but will be significantly shorter on average (up to 10000 characters) than the database string. You should compare the input fragment against database, finding all occurrences of fragment that differ in no more than diffsAllowed positions from a substring of database. Your code should populate one entry in the preallocated matchPosition array for each match found, storing the offset of the character in database that corresponds to the first character of fragment. The FindMatch function should return the number of matches found.

As an example, given the following input

alphabet: ACGU

database: ACGTACGTACGTAAAAAATACGTACGTATA

fragment: ACGTACGTAC

diffsAllowed: 5

your code should find 7 matches and store the following values in matchPosition:

-4 0 4 8 15 19 23


Notice that partial matches can occur at the beginning or the end of database, and as a result, the offsets returned in matchPosition can be negative or greater than strlen(database) - strlen(fragment).

To allow you to do some preprocessing, your InitMatch routine will be called once before a sequence of calls to FindMatch. InitMatch will be called with the same alphabet and database parameters provided to subsequent FindMatch calls. Both routines will also be given the same storage parameter that points to at least 1MB of memory allocated and initialized to zero by the calling routine. FindMatch will be called between 100 and 1000 times, on average, for each call to InitMatch. The winning solution will be the one with the fastest execution time, including the execution time for both InitMatch and FindMatch.

Other fine print: The alphabet characters will be provided in increasing ASCII order. The offsets you store in matchPosition need not be in any particular order. The value for diffsAllowed will typically be smaller than 50% of strlen(fragment). Finally, you should not allocate any dynamic storage in your solution beyond that provided in the storage parameter.

This will be a native PowerPC Challenge using the latest Symantec environment. Solutions may be coded in C or C++.

Two Months Ago Winner

Congratulations to Randy Boring for submitting the fastest entry to the A-Maze-ing Programmer’s Challenge. The Challenge this month was to write code that would find a path leading out of a three-dimensional maze. The solutions were provided with the maze size, an initial position, some storage for use in mapping the maze, and a callback routine. The callback provided the result of attempting to move in a given direction, indicating whether the attempt to move succeeded, failed because there was no opening in the specified direction, resulted in a fall down a shaft in the mine, or found an exit to the mine. Of the four entries submitted, only two successfully solved all of my test mazes; one of the entries crashed, and one went into an infinite loop.

The table below summarizes the results for each correct entry, including the language in which the solution was written, the size of the solution code, the amount of static data used by the solution, the total execution time for all test cases, and the number of moves needed to solve the mazes.

Name Language Code Size Data Size Time Moves

Randy Boring C++ 2792 484 343153 33519

Jay Negro C++ 1788 51 40945114 7120802

The test mazes used in the evaluation ranged in size from 10x20x30 to 100x100x200, and ranged in density (the percentage of open cells) from 10% to 20%. As indicated in the problem statement, a path to an exit was guaranteed to exist from any cell reachable from the starting position.

Randy’s winning entry spent more time processing each move than the second place entry from first-time Challenge contestant Jay Negro, but Randy’s code solved the maze using significantly fewer moves and executed two orders of magnitude more quickly. His code maintains a queue of what are believed to be the best moves to try. As long as there are moves in the best move list, it invokes the callback with the best move, checks for success, and then updates the map with what it has learned about the maze position it just tried. The CalcBestMove routine determines the best possible move (surprise!) by first moving toward an adjacent maze boundary if one exists, or moving toward the nearest maze boundary if nothing is known about the current position, or trying adjacent positions about which nothing is known, or finally by moving toward a position about which nothing is known. The CalcBestMove heuristics, along with judicious use of inline functions and some optimization of maze offset calculations, combined to make this an efficient solution.

Careful readers of the code will note one potential problem with the Initialize routine, in that it simply gives up and returns if it is unable to allocate enough memory. This could have caused the winning entry to fail for larger mazes when given only the amount of memory guaranteed by the problem. However, the size of the mazes that I could practically evaluate was limited by the speed of the other entries, and the memory problem did not show up with those cases, so I elected to ignore it. Under other circumstances, proper handling of low memory conditions would have been required to win.

TOP 20 CONTESTANTS

Here are the Top 20 Contestants for the Programmer’s Challenge. The numbers below include points awarded over the 24 most recent contests, including points earned by this month’s entrants.

RankNamePoints
1.Munter, Ernst193
2.Gregg, Xan92
3.Larsson, Gustav87
4.[Name deleted]60
5.Lengyel, Eric40
6.Lewis, Peter30
7.Boring, Randy27
8.Beith, Gary24
9.Kasparian, Raffi22
10.Vineyard, Jeremy22
11.Cutts, Kevin21
12.Picao, Miguel Cruz21
13.Brown, Jorg20
14.Gundrum, Eric20
15.Karsh, Bill19
16.Stenger, Allen19
17.Cooper, Greg17
18.Mallett, Jeff17
19.Nevard, John17
20.Nicolle, Ludovic14

There are three ways to earn points: (1) scoring in the top 5 of any Challenge, (2) being the first person to find a bug in a published winning solution or, (3) being the first person to suggest a Challenge that I use. The points you can win are:

1st place20 points
2nd place10 points
3rd place7 points
4th place4 points
5th place2 points
finding bug2 points
suggesting Challenge2 points

Here is Randy’s winning solution:

Amazing.cp

Copyright © 1996 Randy Boring

typedef Boolean (*MoveProc) (
 long xMove,long yMove,long zMove,
 long *newXPos,long *newYPos,long *newZPos
 );

// the MoveProc, MakeAMove, is a callback.  It returns true if you 
// have found your way out of the maze.
// You give it (x,y,z) as a delta from your current position,
// each from [-1, 0, 1].  Straight up and straight down (and all zeroes)
// always result in no movement. 

Boolean Maze (long xMove, // these are your initial position
 long yMove,
 long zMove,
 long xSize,// these are the dimensions of the maze
 long ySize,
 long zSize,
 MoveProc MakeAMove, // this is your callback routine
 char *mapStorage// this is your preallocated storage
 );// (one char per position in maze)

Typedefs and Constants
typedef long dirT; // direction enumerator (0-24)

static
const long dir2dx[25]={9,
 -1, 0, 1,  -1, 1,  -1, 0, 1,
 -1, 0, 1,  -1, 1,  -1, 0, 1,
 -1, 0, 1,  -1, 1,  -1, 0, 1,};
static
const long dir2dy[25]={9, 
 1, 1, 1,   0, 0,  -1,-1,-1,
  1, 1, 1,   0, 0,  -1,-1,-1,
  1, 1, 1,   0, 0,  -1,-1,-1,};
static
const long dir2dz[25]={9,
  1, 1, 1,   1, 1,   1, 1, 1,
  0, 0, 0,   0, 0,   0, 0, 0,
 -1,-1,-1,  -1,-1,  -1,-1,-1,};
static
const dirT di[3][3][3] = {
  {{1,2,3},{4,0,5},{6,7,8}},
  {{9,10,11},{12,0,13},{14,15,16}},
  {{17,18,19},{20,0,21},{22,23,24}}};
static const dirT kNoDir = 0;
static const dirT kFirstDir = 1;
static const dirT kLastDir = 24;
static const dirT kNumDirs = 25; // including kNoDir at zero
static const char kUnknown = 0;  // unknown square
    // every type below is known
static const char kWall = 1;// wall
static const char kSpace = 2; // space-above-wall
static const char kFall = 4;// space-above-space
static const char kTriedSpace = 10;// searched space
static const char kTriedFall = 12; // searched fall

static const short kTakeProb = 4;  // 1/4th
static const long kSTNBlockSize = 48;

typedef long squareIndexT;
typedef struct STN {
 struct STN *parent;
 squareIndexT square;// square index of this node
 dirT   direction; // how I got here from my parent
 } SearchTreeNode, *STNPtr, **STNHandle;

Globals
static STNPtr gTreeRoot;
static STNPtr gTreeTop;
static STNPtr gQHead;
static STNPtr gQTail;
static STNPtr gBestMoveList;
static STNHandle gTreeRootH;
static STNHandle gBestMoveListH;
static STNPtr gBestMoveListNextPos;

Defines 
#define myIsUnknown(sq) (kUnknown == (sq))
#define myIsKnown(sq)(kUnknown != (sq))
    // the below should only be used when the square is known
#define myIsWall(sq) (kWall == (sq))
#define myIsUntriedWalkable(sq)  (kSpace == (sq))
#define myIsOpen(sq) (0x00 == (0x01 & (sq)))
#define myIsWalkable(sq) (0x02 == (0x02 & (sq)))
#define myIsUntriedFall(sq) (kFall == (sq))
#define myIsFall(sq) (0x04 == (0x04 & (sq)))
#define myIsTried(sq)(0x08 == (0x08 & (sq)))
#define d2x(d) (dir2dx[d])
#define d2y(d) (dir2dy[d])
#define d2z(d) (dir2dz[d])
#define xvec(d) (d2x(d))
#define yvec(d,xN) (d2y(d) * (xN))
#define zvec(d,xyN) (d2z(d) * (xyN))
#define offsetD(d,xN,xyN) (xvec(d) + yvec(d,xN) + zvec(d,xyN))
#define offsetXYZ(x,y,z,xN,xyN) ((x) + (y) * xN + (z) * (xyN))
#define map(m,x,y,z,xN,xyN) (*(m + (x) + (y) * xN + (z) * (xyN)))

#ifdef powerc
#define BreakToSourceDebugger_()   Debugger()
#else   // 68K
#define BreakToSourceDebugger_()   SysBreak()
#endif  // powerc


isEmptySearchQ
static inline Boolean
isEmptySearchQ() {return (gQHead == gQTail);}

isFullSearchQ
static inline Boolean
isFullSearchQ() {return (gTreeTop <= gQTail);}

DeQ
static inline STNPtr
DeQ(void) {return gQHead++;}

EnQ
static inline STNPtr
EnQ(void) {
 STNPtr p = gQTail++;
    //if (isFullSearchQ())
    //    BreakToSourceDebugger_();
 return (p);
}

EnQNewCandidate
// Add this move (direction to a square index) to the tree at the current node, assumes 
// the square index has not already been visited by this search.
static void
EnQNewCandidate(STNPtr parent, const long sqi, 
 const dirT d)
{
STNPtr newNode = EnQ();
newNode->parent = parent;
newNode->direction = d;
newNode->square = sqi;
}

isEmptySearchTree
static inline Boolean
isEmptySearchTree() {return (gTreeRoot == gQTail);}

PopSearchTree
static inline long
PopSearchTree(void) {return ((-gQTail)->square);}

NewSearchTree
static void
NewSearchTree(void) {
 gQTail = gQHead = gTreeRoot;
 gQTail++;// the only time we’re called,
}//  gTreeRoot is immediately the EnQed elem.

DisposeSearchTree
static void
DisposeSearchTree(char *m) {
while (!isEmptySearchTree()) {
    // remove ‘tried’ mark
 *(m + PopSearchTree()) = kSpace;
 }
}

isEmptyMoveList
static inline Boolean
isEmptyMoveList()
 {return (gBestMoveListNextPos == gBestMoveList);}

PushMoveList
static inline void
PushMoveList(const dirT d) {
 gBestMoveListNextPos->direction = d;
 gBestMoveListNextPos++;}

PopMoveList
static inline dirT
PopMoveList(void) {
 -gBestMoveListNextPos;
 return (gBestMoveListNextPos->direction);}

NewBestMoveList
static void
NewBestMoveList(void) {gBestMoveListNextPos = gBestMoveList;}

SetBestMove
// Copy the sequence of best directions-to-move to the
// best move list.  (The tree is about to be freed.)
static void
SetBestMove(STNPtr node, const dirT d)
{
PushMoveList(d);
while (kNoDir != node->direction) { // the root’s dir
 PushMoveList(node->direction);
 node = node->parent;
 }
}

Initialize
// Initialize everything for the routine
// map is already initialized to zeroes (kUnknown == 0)
static Boolean
Initialize(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
const long xySize = xSize * ySize;
long treeBytesWanted = sizeof(SearchTreeNode)
 * ((xSize - 2) * (ySize - 2) * (zSize - 2) + 4);
long treeBytesNeeded = sizeof(SearchTreeNode)
 * ((xSize - 2) + (ySize - 2) + (zSize - 2) + 1);
Boolean succeed = true;

map(m,x,y,z,xSize,xySize) = kSpace;
map(m,x,y,z-1,xSize,xySize) = kWall;

gBestMoveListH = (STNHandle) NewHandle(sizeof(SearchTreeNode)
 * (zSize + xySize) * 2);
if (!gBestMoveListH) succeed = false;
 // unable to initialize successfully,MEM
HLock((Handle) gBestMoveListH);
gBestMoveList = *gBestMoveListH;

do {
 gTreeRootH = (STNHandle) NewHandle(treeBytesWanted);
 treeBytesWanted *= 0.9;
 }
 while (!gTreeRootH && 
 (treeBytesNeeded <= treeBytesWanted));
if (!gTreeRootH) succeed = false;
 // unable to initialize successfully,MEM
HLock((Handle) gTreeRootH);
gTreeRoot = *gTreeRootH;

NewBestMoveList();
return succeed;
}


DeInitialize
// Free everything we allocated
static void
DeInitialize()
{
HUnlock((Handle) gBestMoveListH);
DisposeHandle((Handle) gBestMoveListH);
HUnlock((Handle) gTreeRootH);
DisposeHandle((Handle) gTreeRootH);
}


AtEdge
// Are we at an edge?
// return true if we are
static Boolean
AtEdge(const long x, const long y, const long z,
 const long xMax, const long yMax, const long zMax)
{
if (0==x || 0==y || 0==z) return true;
if (xMax==x || yMax==y || zMax==z) return true;
return false;
}


MapMove
// Map the move we just made/tried.
// I.e., store our new knowledge of the maze in the map
static void
MapMove(const long oldx, const long oldy, const long oldz,
 const long newx, const long newy, const long newz,
 char *m, const long xN, const long xyN,
 const long dx, const long dy, const long dz)
{
long x = oldx + dx; // where we tried to move
long y = oldy + dy; // (we need these in either case below)
long z = oldz + dz;
long sqi = offsetXYZ(x, y, z, xN, xyN);
if (newx==oldx && newy==oldy && newz==oldz) { // bump!
    // mark as wall the square we bumped into
 *(m + sqi) = kWall;
    // lastTried was not successful
    //gLastWasSuccess = false;
 }
else {
    // mark as clear any squares we fell through
    // actually mark them with as fall because they can’t
    // really be moved ‘to’ only through, downwards.
 if (newz < z) {
 do {
 *(m + sqi) = kFall;
 z-;
 sqi -= xyN;
 } while (newz < z);
 }
    // mark as clear our current space
 *(m + sqi) = kSpace;
    // mark as ‘wall’ the square we are standing on
 sqi -= xyN;
 *(m + sqi) = kWall;
    // lastTried was successful
    //gLastWasSuccess = true;
    // direction of last success
    //gLastSuccess = lastTried;
 }
}


APossibleExit
// return a direction in which
// there may be an adjacent exit.
// A possible exit must be both an edge and untried.
static dirT
APossibleExit(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m, dirT lastTried)
{
dirT tryD = lastTried + 1; // start here
/* check for edge conditions first */
if (x > 1 && x < xSize - 2)
 if (y > 1 && y < ySize - 2)
 if (z > 1 && z < zSize - 2)
    /* no exits are possibly nearby */
    /* because no edges are nearby */
 return kNoDir; // zero

/* search the adjacent spaces for a possible exit */
/* this could improve a lot */
while (tryD <= kLastDir) {
 const long dx = d2x(tryD);
 const long dy = d2y(tryD);
 const long dz = d2z(tryD);
 if (AtEdge(x+dx, y+dy, z+dz, xSize-1, ySize-1, zSize-1))
 if (myIsUnknown(map(m, x + dx, y + dy, z + dz,
 xSize, xSize * ySize)))
 return tryD;
 tryD++;
 }
tryD = kFirstDir;
while (tryD <= lastTried) {
 const long dx = d2x(tryD);
 const long dy = d2y(tryD);
 const long dz = d2z(tryD);
 if (AtEdge(x+dx, y+dy, z+dz, xSize-1, ySize-1, zSize-1))
 if (myIsUnknown(map(m, x + dx, y + dy, z + dz,
 xSize, xSize * ySize)))
 return tryD;
 tryD++;
 }
return kNoDir; // zero, no possible exit found nearby
}


TotallyUnknown
// returns true if every move leads to an unknown square
// this is only possible at the beginning and after falling
// at least three below our last position.
static Boolean
TotallyUnknown(const long x, const long y, const long z,
 const long xSize, const long xySize, char *m)
{
dirT dir;
/* loop through the directions until we find a known spot */
for (dir = kFirstDir; dir <= kLastDir; dir++) {
 const long dx = d2x(dir);
 const long dy = d2y(dir);
 const long dz = d2z(dir);
 if (!myIsUnknown(map(m, x + dx, y + dy, z + dz,
 xSize, xySize)))
 return false;
 }
return true;
}


MoveTowardsNearWall
// Pick a move that is towards a near wall
// (NOTE: only used when all directions are unknown)
static dirT
MoveTowardsNearWall(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
#pragma unused (m)
long distx = xSize - x - 1; // distance from x==xMax edge
long disty = ySize - y - 1; // distance from y==yMax edge
long distz = zSize - z - 1; // distance from z==zMax edge
// [xyz] is distance from [xyz]==0 edge
long dx, dy, dz;
long xy = xSize * ySize;

if (x < distx) dx = -1;
else if (x == distx) dx = 0;
else dx = 1;
if (y < disty) dy = -1;
else if (y == disty) dy = 0;
else dy = 1;
if (z < distz) dz = -1;
else if (z == distz) dz = 0;
else dz = 1;

return di[dy+1][dz+1][dx+1];
}


Gravity
// Fall until we find a floor below us
// Only use after mapping new knowledge
// (Don’t use during mapping)
static long
Gravity(long i, const char *m, const long xySize)
{
do {i -= xySize;}
 while (kWall != *(m + i));
 
return i + xySize;
}


SearchOneSquare
// Search from this square for an adjacent unknown square
// queueing up moveable squares (including spaces below
// falls) for further research later,
// marking enqueued squares as ‘tried’ (immediately meaning
// ‘not-to-be-queued-for-trying’, later ‘actually-tried’)
// NOTE: while I could mark falls as tried (upward from
// every space) they are rather unlikely to be in the
// search path, so it’s not worth it.  Just re-enact
// gravity each time, and check last square for ‘tried’.
static Boolean
SearchOneSquare(STNPtr startSTN,
 const long xSize, const long xySize, char *m)
{
dirT d;
const long startSquare = startSTN->square;

for (d = kFirstDir; d <= kLastDir; d++) {
 const long sqi = startSquare + offsetD(d,xSize,xySize);
 const char sq = *(m + sqi);
 if (myIsUnknown(sq)) {
 SetBestMove(startSTN, d);
 return true;
 }
 else if (myIsUntriedWalkable(sq)) {
 EnQNewCandidate(startSTN,sqi,d);
 *(m + sqi) = kTriedSpace;
 }
 else if (myIsUntriedFall(sq)) {
 const long bottomSqi = Gravity(sqi,m,xySize);
 const long bottomSq = *(m + bottomSqi);
 if (myIsUntriedWalkable(sq)) {
 EnQNewCandidate(startSTN,bottomSqi,d);
 *(m + bottomSqi) = kTriedSpace;
 }
    //else if (myIsUnknown(bottomSq)) {
    //    BreakToSourceDebugger_(); // should be impossible
    //    return true; //??
    //    }
 else ; //it’s an already tried space, do nothing
 }
 else ; // it’s a wall or already tried space, do nothing
 }
return false;
}


FindNearestUnknown
// Find a move sequence that will lead to an unknown
// square (preferably an edge square?).
static dirT
FindNearestUnknown(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
#pragma unused (zSize)
const long xySize = xSize * ySize;
Boolean found = false;
// make new search tree with square at x,y,z
NewSearchTree();
NewBestMoveList();
gTreeRoot->parent = nil;
gTreeRoot->square = offsetXYZ(x,y,z,xSize,xySize);
gTreeRoot->direction = kNoDir;
*(m + gTreeRoot->square) = kTriedSpace;
// fan out from this one layer at a time
while (!isEmptySearchQ() && !found) {
 STNPtr tryNode = DeQ();
 found = SearchOneSquare(tryNode, xSize, xySize, m);
    //FreeSTN(tryNode);
 }
DisposeSearchTree(m);
// found move(list) or failed
return found;
}


CalcBestMove
// Calculate the best move to try
// return true if we have found an exit or are at wit’s end
static dirT
CalcBestMove(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
static dirT lastTried = kNoDir;
dirT d;

if (!isEmptyMoveList()) { // we have a pre-made list of moves

 

Community Search:
MacTech Search:

Software Updates via MacUpdate

Macs Fan Control 1.5.14 - Monitor and co...
Macs Fan Control allows you to monitor and control almost any aspect of your computer's fans, with support for controlling fan speed, temperature sensors pane, menu-bar icon, and autostart with... Read more
VueScan 9.7.96 - Scanner software with a...
VueScan is a scanning program that works with most high-quality flatbed and film scanners to produce scans that have excellent color fidelity and color balance. VueScan is easy to use, and has... Read more
FileMaker Pro 19.6.1 - Quickly build cus...
FileMaker Pro is the tool you use to create a custom app. You also use FileMaker Pro to access your app on a computer. Start by importing data from a spreadsheet or using a built-in Starter app to... Read more
Duet 3.1.0.0 - Use your iPad as an exter...
Duet is the first app that allows you to use your iDevice as an extra display for your Mac using the Lightning or 30-pin cable. Note: This app requires a iOS companion app. Release notes were... Read more
Firefox 107.0.1 - Fast, safe Web browser...
Firefox offers a fast, safe Web browsing experience. Browse quickly, securely, and effortlessly. With its industry-leading features, Firefox is the choice of Web development professionals and casual... Read more
War Thunder 2.21.1.91 - Multiplayer war...
In War Thunder, aircraft, attack helicopters, ground forces and naval ships collaborate in realistic competitive battles. You can choose from over 1,500 vehicles and an extensive variety of combat... Read more
Numbers 12.2.1 - Apple's spreadshee...
With Apple Numbers, sophisticated spreadsheets are just the start. The whole sheet is your canvas. Just add dramatic interactive charts, tables, and images that paint a revealing picture of your data... Read more
DEVONthink Pro 3.8.7 - Knowledge base, i...
DEVONthink is DEVONtechnologies' document and information management solution. It supports a large variety of file formats and stores them in a database enhanced by artificial intelligence (AI). Many... Read more
Drive Genius 6.2.3 - $79.00
Drive Genius features a comprehensive Malware Scan. Automate your malware protection. Protect your investment from any threat. The Malware Scan is part of the automated DrivePulse utility. DrivePulse... Read more
VLC Media Player 3.0.18 - Popular multim...
VLC Media Player is a highly portable multimedia player for various audio and video formats (MPEG-1, MPEG-2, MPEG-4, DivX, MP3, OGG, ...) as well as DVDs, VCDs, and various streaming protocols. It... Read more

Latest Forum Discussions

See All

TouchArcade Game of the Week: ‘Sling Min...
The world of PC games has always blown my mind because there’s just SO MUCH stuff out there that it’s not uncommon at all for there to be a game that’s well-liked and well-reviewed, and seemingly quite popular with a solid fanbase, and have it be... | Read more »
SwitchArcade Round-Up: Reviews Featuring...
Hello gentle readers, and welcome to the SwitchArcade Round-Up for December 2nd, 2022. So, today turned out a little quieter than the usual Friday. It was so quiet, in fact, that I decided to pen a few reviews. The Knight Witch, Railbound, and Donut... | Read more »
Blue Archive reveals its latest event st...
Nexon has announced the new update for Blue Archive, under the name of An Unconcealed Heart. Featuring a battle between two academies, the story will follow a group struggling to gain recognition, and will bring three new students to recruit. [... | Read more »
Dead Cells+ Is Out Now on Apple Arcade a...
Following the major update for Dead Cells on iOS and Android a few days ago, Playdigious has brought Dead Cells+ () to Apple Arcade. As an App Store Great, Dead Cells+ includes all prior paid DLC and content updates. It also has exclusive mobile... | Read more »
SwitchArcade Round-Up: ‘Romancing SaGa’,...
Hello gentle readers, and welcome to the SwitchArcade Round-Up for December 1st, 2022. Wow, December. We’re already at the last month of the year? Phew. I have a lot of work to finish in the next few weeks. As for today, we’ve got a little news, a... | Read more »
‘Railbound’ Update Now Available Adding...
One of our favorite puzzlers released this year is Railbound from Afterburn Games, which hit in early September and earned our Game of the Week recognition for being an absolutely ace logic puzzler. The goal is to place rail pieces down in order to... | Read more »
The Seven Deadly Sins: Grand Cross celeb...
Netmarble Corporation has pulled out all the stops to celebrate the 3 and a half year anniversary of The Seven Deadly Sins: Grand Cross. The Grand Cross 3.5th Year Anniversary the Ultimate One, a rather wordy title, brings with it a brand new... | Read more »
‘Skullgirls Mobile’ Major Update 5.2 Out...
Developer Hidden Variable pushed out a major update for Skullgirls Mobile (Free) a few hours ago. The version 5.2 update brings in Black Dahlia (before the console and PC game), Retakes, XP Treats, free gifts, and more. Since launch, Skullgirls... | Read more »
Out Now: ‘Disgaea 4’, ‘Romancing SaGa: M...
Each and every day new mobile games are hitting the App Store, and so each week we put together a big old list of all the best new releases of the past seven days. Back in the day the App Store would showcase the same games for a week, and then... | Read more »
SwitchArcade Round-Up: ‘Elevator Action...
Hello gentle readers, and welcome to the SwitchArcade Round-Up for November 30th, 2022. We’re finishing up the month on a quiet note, friends. There are five new releases to look at today, with a few notables amongst them. We’ve got summaries for... | Read more »

Price Scanner via MacPrices.net

New Holiday Sale: Apple retailers are offerin...
Several Apple retailers lowered prices on 10.9″ iPad Airs overnight to lows of $100 off MSRP starting at $499. Their prices are the lowest available for iPad Airs anywhere this Holiday season right... Read more
New Holiday sale at Amazon: Take $50 off Appl...
Amazon has Apple’s new 10th-generation iPads in stock and on sale, for the first time, for $50 off MSRP starting at only $399. Their discount applies to all models and all colors. With the discount,... Read more
Holiday Sale: Get an 8.3″ Apple iPad mini for...
Sams Club has 10.9″ 64GB iPad minis on Holiday sale for $80-$100 off MSRP through December 7, 2022. With their discount, prices start at $399 — the cheapest price for a new iPad mini from any of the... Read more
Sams Club Holiday December Event sale: Apple...
Apple AirPods Max headphones are on sale at Sams Club for $110 off MSRP ($439) as part of their December Event sale, ending on December 7, 2022, valid for all colors. Sale price for online orders... Read more
Apple’s 10.2″ 64GB 9th-generation iPads are o...
Sams Club has 9th-generation 64GB iPads on Holiday sale for $60 off MSRP through December 7, 2022. With their discount, prices start at $259 — the cheapest price for a new iPad from any of the Apple... Read more
11″ 128GB WiFi M2 iPad Pro on sale for $749,...
B&H Photo has the new 11″ 128GB WiFi M2-powered iPad Pro (in Space Gray or Silver) on Holiday sale for $749 including free 1-2 day shipping to most US addresses. Their price is $50 off MSRP and... Read more
Find the best Holiday sale price on an iPad u...
We’ve updated our iPad Price Trackers with the latest information on the new 10th-generation iPads, M2-powered iPad Pros, M1 iPad Airs, iPad minis, and 9th generation iPads from Apple’s authorized... Read more
Apple retailers are offering $100-$150 Holida...
Apple retailers have posted their most-recent Holiday sale prices on 13″ MacBook Airs. Take up to $150 off MSRP on M2-powered Airs with these sales with prices starting at only $1099. Free shipping... Read more
Holiday Sale: Apple’s 14″ MacBook Pros with M...
B&H Photo is offering $200-$300 discounts on Apple’s 14″ MacBook Pros with M1 Pro CPUs as part of their Holiday 2022 sale, with prices starting at $1799. Free 1-2 day shipping is available to... Read more
Deal Alert! 50% off Apple MagSafe Chargers
AT&T has Apple MagSafe Chargers on sale for 50% off MSRP as part of their Holiday sale. Service is not required to take advantage of these savings. With the discounts, their sale prices are the... Read more

Jobs Board

Support Technician II - *Apple* Support - O...
…problems and acting as a liaison between customers and resolving groups. As an Apple Technical Specialist, you will be supporting many of our popular Apple Read more
*Apple* Electronic Repair Technician - PlanI...
…a highly motivated individual to join our Production Department as an Apple Electronic Repair Technician. The computer repair technician will diagnose, assemble, Read more
Lead Developer - *Apple* tvOS - Rumble (Uni...
…earnings, and positive sentiment About the role: We are looking for a Lead Apple tvOS Developer to join our application engineering team to expand our video centric Read more
Tier 1 Endpoint Engineer - *Apple* - Red Ri...
…Desk on site, at our Client's location, with a focus on support to Apple products. This position will handle technical support requests directly from customers and Read more
Product Manager II - *Apple* - DISH (United...
…you will be doing We seek an ambitious, data-driven thinker to assist the Apple Product Development team as our new Retail Wireless division continues to grow and Read more
All contents are Copyright 1984-2011 by Xplain Corporation. All rights reserved. Theme designed by Icreon.