TweetFollow Us on Twitter

Oct 96 Challenge
Volume Number:12
Issue Number:10
Column Tag:Programmer’s Challenge

Programmer’s Challenge

By Bob Boonstra

Note: Source code files accompanying article are located on MacTech CD-ROM or source code disks.

DNA Match

This month’s Challenge is based on a suggestion submitted by Vicente Giles of the Universidad de Málaga. Vincente faces a real-world problem to look for all the genomic sequences that match certain

criteria, given a DNA database sequence and a problem sequence. A DNA sequence is a string of the four different nucleotides involved in the genetic code, denoted ‘A’, ‘C’, ‘G’, and ‘U’, which stand for adenine, cytosine, guanine, and uracil. The problem is to find all possible matches of the problem sequence in the database sequence, allowing a specified number of differences.

The prototype for the code you should write is:

long FindMatch(
 char *alphabet, /* legal characters for database and fragment strings */
 char *database, /* reference string to compare fragments against */
 void *storage,  /* storage preallocated for your use */
 char *fragment, /* string to match against database */
 long diffsAllowed,/* differences allowed between fragment and database */
 long matchPosition[]/* return match positions in this array*/
);

void InitMatch(
 char *alphabet, /* legal characters for database and fragment strings */
 char *database, /* reference string to compare fragments against */
 void *storage   /* storage preallocated for your use */
);

Because we would like our DNA-matching algorithm to be useful even if scientists discover an extraterrestrial genetic code based on other nucleotides, the algorithm accepts the genetic alphabet as a parameter. In the problem posed by Vincente, this would be the string “ACGU”, but in our Challenge it might include any of the characters ‘a’..’z’ or ‘A’..’Z’ (Extraterrestrial DNA is case sensitive). The null-terminated reference string contained in the database parameter can be up to 1000000000 (109) characters long. The fragment that you are to match is also null-terminated, but will be significantly shorter on average (up to 10000 characters) than the database string. You should compare the input fragment against database, finding all occurrences of fragment that differ in no more than diffsAllowed positions from a substring of database. Your code should populate one entry in the preallocated matchPosition array for each match found, storing the offset of the character in database that corresponds to the first character of fragment. The FindMatch function should return the number of matches found.

As an example, given the following input

alphabet: ACGU

database: ACGTACGTACGTAAAAAATACGTACGTATA

fragment: ACGTACGTAC

diffsAllowed: 5

your code should find 7 matches and store the following values in matchPosition:

-4 0 4 8 15 19 23


Notice that partial matches can occur at the beginning or the end of database, and as a result, the offsets returned in matchPosition can be negative or greater than strlen(database) - strlen(fragment).

To allow you to do some preprocessing, your InitMatch routine will be called once before a sequence of calls to FindMatch. InitMatch will be called with the same alphabet and database parameters provided to subsequent FindMatch calls. Both routines will also be given the same storage parameter that points to at least 1MB of memory allocated and initialized to zero by the calling routine. FindMatch will be called between 100 and 1000 times, on average, for each call to InitMatch. The winning solution will be the one with the fastest execution time, including the execution time for both InitMatch and FindMatch.

Other fine print: The alphabet characters will be provided in increasing ASCII order. The offsets you store in matchPosition need not be in any particular order. The value for diffsAllowed will typically be smaller than 50% of strlen(fragment). Finally, you should not allocate any dynamic storage in your solution beyond that provided in the storage parameter.

This will be a native PowerPC Challenge using the latest Symantec environment. Solutions may be coded in C or C++.

Two Months Ago Winner

Congratulations to Randy Boring for submitting the fastest entry to the A-Maze-ing Programmer’s Challenge. The Challenge this month was to write code that would find a path leading out of a three-dimensional maze. The solutions were provided with the maze size, an initial position, some storage for use in mapping the maze, and a callback routine. The callback provided the result of attempting to move in a given direction, indicating whether the attempt to move succeeded, failed because there was no opening in the specified direction, resulted in a fall down a shaft in the mine, or found an exit to the mine. Of the four entries submitted, only two successfully solved all of my test mazes; one of the entries crashed, and one went into an infinite loop.

The table below summarizes the results for each correct entry, including the language in which the solution was written, the size of the solution code, the amount of static data used by the solution, the total execution time for all test cases, and the number of moves needed to solve the mazes.

Name Language Code Size Data Size Time Moves

Randy Boring C++ 2792 484 343153 33519

Jay Negro C++ 1788 51 40945114 7120802

The test mazes used in the evaluation ranged in size from 10x20x30 to 100x100x200, and ranged in density (the percentage of open cells) from 10% to 20%. As indicated in the problem statement, a path to an exit was guaranteed to exist from any cell reachable from the starting position.

Randy’s winning entry spent more time processing each move than the second place entry from first-time Challenge contestant Jay Negro, but Randy’s code solved the maze using significantly fewer moves and executed two orders of magnitude more quickly. His code maintains a queue of what are believed to be the best moves to try. As long as there are moves in the best move list, it invokes the callback with the best move, checks for success, and then updates the map with what it has learned about the maze position it just tried. The CalcBestMove routine determines the best possible move (surprise!) by first moving toward an adjacent maze boundary if one exists, or moving toward the nearest maze boundary if nothing is known about the current position, or trying adjacent positions about which nothing is known, or finally by moving toward a position about which nothing is known. The CalcBestMove heuristics, along with judicious use of inline functions and some optimization of maze offset calculations, combined to make this an efficient solution.

Careful readers of the code will note one potential problem with the Initialize routine, in that it simply gives up and returns if it is unable to allocate enough memory. This could have caused the winning entry to fail for larger mazes when given only the amount of memory guaranteed by the problem. However, the size of the mazes that I could practically evaluate was limited by the speed of the other entries, and the memory problem did not show up with those cases, so I elected to ignore it. Under other circumstances, proper handling of low memory conditions would have been required to win.

TOP 20 CONTESTANTS

Here are the Top 20 Contestants for the Programmer’s Challenge. The numbers below include points awarded over the 24 most recent contests, including points earned by this month’s entrants.

RankNamePoints
1.Munter, Ernst193
2.Gregg, Xan92
3.Larsson, Gustav87
4.[Name deleted]60
5.Lengyel, Eric40
6.Lewis, Peter30
7.Boring, Randy27
8.Beith, Gary24
9.Kasparian, Raffi22
10.Vineyard, Jeremy22
11.Cutts, Kevin21
12.Picao, Miguel Cruz21
13.Brown, Jorg20
14.Gundrum, Eric20
15.Karsh, Bill19
16.Stenger, Allen19
17.Cooper, Greg17
18.Mallett, Jeff17
19.Nevard, John17
20.Nicolle, Ludovic14

There are three ways to earn points: (1) scoring in the top 5 of any Challenge, (2) being the first person to find a bug in a published winning solution or, (3) being the first person to suggest a Challenge that I use. The points you can win are:

1st place20 points
2nd place10 points
3rd place7 points
4th place4 points
5th place2 points
finding bug2 points
suggesting Challenge2 points

Here is Randy’s winning solution:

Amazing.cp

Copyright © 1996 Randy Boring

typedef Boolean (*MoveProc) (
 long xMove,long yMove,long zMove,
 long *newXPos,long *newYPos,long *newZPos
 );

// the MoveProc, MakeAMove, is a callback.  It returns true if you 
// have found your way out of the maze.
// You give it (x,y,z) as a delta from your current position,
// each from [-1, 0, 1].  Straight up and straight down (and all zeroes)
// always result in no movement. 

Boolean Maze (long xMove, // these are your initial position
 long yMove,
 long zMove,
 long xSize,// these are the dimensions of the maze
 long ySize,
 long zSize,
 MoveProc MakeAMove, // this is your callback routine
 char *mapStorage// this is your preallocated storage
 );// (one char per position in maze)

Typedefs and Constants
typedef long dirT; // direction enumerator (0-24)

static
const long dir2dx[25]={9,
 -1, 0, 1,  -1, 1,  -1, 0, 1,
 -1, 0, 1,  -1, 1,  -1, 0, 1,
 -1, 0, 1,  -1, 1,  -1, 0, 1,};
static
const long dir2dy[25]={9, 
 1, 1, 1,   0, 0,  -1,-1,-1,
  1, 1, 1,   0, 0,  -1,-1,-1,
  1, 1, 1,   0, 0,  -1,-1,-1,};
static
const long dir2dz[25]={9,
  1, 1, 1,   1, 1,   1, 1, 1,
  0, 0, 0,   0, 0,   0, 0, 0,
 -1,-1,-1,  -1,-1,  -1,-1,-1,};
static
const dirT di[3][3][3] = {
  {{1,2,3},{4,0,5},{6,7,8}},
  {{9,10,11},{12,0,13},{14,15,16}},
  {{17,18,19},{20,0,21},{22,23,24}}};
static const dirT kNoDir = 0;
static const dirT kFirstDir = 1;
static const dirT kLastDir = 24;
static const dirT kNumDirs = 25; // including kNoDir at zero
static const char kUnknown = 0;  // unknown square
    // every type below is known
static const char kWall = 1;// wall
static const char kSpace = 2; // space-above-wall
static const char kFall = 4;// space-above-space
static const char kTriedSpace = 10;// searched space
static const char kTriedFall = 12; // searched fall

static const short kTakeProb = 4;  // 1/4th
static const long kSTNBlockSize = 48;

typedef long squareIndexT;
typedef struct STN {
 struct STN *parent;
 squareIndexT square;// square index of this node
 dirT   direction; // how I got here from my parent
 } SearchTreeNode, *STNPtr, **STNHandle;

Globals
static STNPtr gTreeRoot;
static STNPtr gTreeTop;
static STNPtr gQHead;
static STNPtr gQTail;
static STNPtr gBestMoveList;
static STNHandle gTreeRootH;
static STNHandle gBestMoveListH;
static STNPtr gBestMoveListNextPos;

Defines 
#define myIsUnknown(sq) (kUnknown == (sq))
#define myIsKnown(sq)(kUnknown != (sq))
    // the below should only be used when the square is known
#define myIsWall(sq) (kWall == (sq))
#define myIsUntriedWalkable(sq)  (kSpace == (sq))
#define myIsOpen(sq) (0x00 == (0x01 & (sq)))
#define myIsWalkable(sq) (0x02 == (0x02 & (sq)))
#define myIsUntriedFall(sq) (kFall == (sq))
#define myIsFall(sq) (0x04 == (0x04 & (sq)))
#define myIsTried(sq)(0x08 == (0x08 & (sq)))
#define d2x(d) (dir2dx[d])
#define d2y(d) (dir2dy[d])
#define d2z(d) (dir2dz[d])
#define xvec(d) (d2x(d))
#define yvec(d,xN) (d2y(d) * (xN))
#define zvec(d,xyN) (d2z(d) * (xyN))
#define offsetD(d,xN,xyN) (xvec(d) + yvec(d,xN) + zvec(d,xyN))
#define offsetXYZ(x,y,z,xN,xyN) ((x) + (y) * xN + (z) * (xyN))
#define map(m,x,y,z,xN,xyN) (*(m + (x) + (y) * xN + (z) * (xyN)))

#ifdef powerc
#define BreakToSourceDebugger_()   Debugger()
#else   // 68K
#define BreakToSourceDebugger_()   SysBreak()
#endif  // powerc


isEmptySearchQ
static inline Boolean
isEmptySearchQ() {return (gQHead == gQTail);}

isFullSearchQ
static inline Boolean
isFullSearchQ() {return (gTreeTop <= gQTail);}

DeQ
static inline STNPtr
DeQ(void) {return gQHead++;}

EnQ
static inline STNPtr
EnQ(void) {
 STNPtr p = gQTail++;
    //if (isFullSearchQ())
    //    BreakToSourceDebugger_();
 return (p);
}

EnQNewCandidate
// Add this move (direction to a square index) to the tree at the current node, assumes 
// the square index has not already been visited by this search.
static void
EnQNewCandidate(STNPtr parent, const long sqi, 
 const dirT d)
{
STNPtr newNode = EnQ();
newNode->parent = parent;
newNode->direction = d;
newNode->square = sqi;
}

isEmptySearchTree
static inline Boolean
isEmptySearchTree() {return (gTreeRoot == gQTail);}

PopSearchTree
static inline long
PopSearchTree(void) {return ((-gQTail)->square);}

NewSearchTree
static void
NewSearchTree(void) {
 gQTail = gQHead = gTreeRoot;
 gQTail++;// the only time we’re called,
}//  gTreeRoot is immediately the EnQed elem.

DisposeSearchTree
static void
DisposeSearchTree(char *m) {
while (!isEmptySearchTree()) {
    // remove ‘tried’ mark
 *(m + PopSearchTree()) = kSpace;
 }
}

isEmptyMoveList
static inline Boolean
isEmptyMoveList()
 {return (gBestMoveListNextPos == gBestMoveList);}

PushMoveList
static inline void
PushMoveList(const dirT d) {
 gBestMoveListNextPos->direction = d;
 gBestMoveListNextPos++;}

PopMoveList
static inline dirT
PopMoveList(void) {
 -gBestMoveListNextPos;
 return (gBestMoveListNextPos->direction);}

NewBestMoveList
static void
NewBestMoveList(void) {gBestMoveListNextPos = gBestMoveList;}

SetBestMove
// Copy the sequence of best directions-to-move to the
// best move list.  (The tree is about to be freed.)
static void
SetBestMove(STNPtr node, const dirT d)
{
PushMoveList(d);
while (kNoDir != node->direction) { // the root’s dir
 PushMoveList(node->direction);
 node = node->parent;
 }
}

Initialize
// Initialize everything for the routine
// map is already initialized to zeroes (kUnknown == 0)
static Boolean
Initialize(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
const long xySize = xSize * ySize;
long treeBytesWanted = sizeof(SearchTreeNode)
 * ((xSize - 2) * (ySize - 2) * (zSize - 2) + 4);
long treeBytesNeeded = sizeof(SearchTreeNode)
 * ((xSize - 2) + (ySize - 2) + (zSize - 2) + 1);
Boolean succeed = true;

map(m,x,y,z,xSize,xySize) = kSpace;
map(m,x,y,z-1,xSize,xySize) = kWall;

gBestMoveListH = (STNHandle) NewHandle(sizeof(SearchTreeNode)
 * (zSize + xySize) * 2);
if (!gBestMoveListH) succeed = false;
 // unable to initialize successfully,MEM
HLock((Handle) gBestMoveListH);
gBestMoveList = *gBestMoveListH;

do {
 gTreeRootH = (STNHandle) NewHandle(treeBytesWanted);
 treeBytesWanted *= 0.9;
 }
 while (!gTreeRootH && 
 (treeBytesNeeded <= treeBytesWanted));
if (!gTreeRootH) succeed = false;
 // unable to initialize successfully,MEM
HLock((Handle) gTreeRootH);
gTreeRoot = *gTreeRootH;

NewBestMoveList();
return succeed;
}


DeInitialize
// Free everything we allocated
static void
DeInitialize()
{
HUnlock((Handle) gBestMoveListH);
DisposeHandle((Handle) gBestMoveListH);
HUnlock((Handle) gTreeRootH);
DisposeHandle((Handle) gTreeRootH);
}


AtEdge
// Are we at an edge?
// return true if we are
static Boolean
AtEdge(const long x, const long y, const long z,
 const long xMax, const long yMax, const long zMax)
{
if (0==x || 0==y || 0==z) return true;
if (xMax==x || yMax==y || zMax==z) return true;
return false;
}


MapMove
// Map the move we just made/tried.
// I.e., store our new knowledge of the maze in the map
static void
MapMove(const long oldx, const long oldy, const long oldz,
 const long newx, const long newy, const long newz,
 char *m, const long xN, const long xyN,
 const long dx, const long dy, const long dz)
{
long x = oldx + dx; // where we tried to move
long y = oldy + dy; // (we need these in either case below)
long z = oldz + dz;
long sqi = offsetXYZ(x, y, z, xN, xyN);
if (newx==oldx && newy==oldy && newz==oldz) { // bump!
    // mark as wall the square we bumped into
 *(m + sqi) = kWall;
    // lastTried was not successful
    //gLastWasSuccess = false;
 }
else {
    // mark as clear any squares we fell through
    // actually mark them with as fall because they can’t
    // really be moved ‘to’ only through, downwards.
 if (newz < z) {
 do {
 *(m + sqi) = kFall;
 z-;
 sqi -= xyN;
 } while (newz < z);
 }
    // mark as clear our current space
 *(m + sqi) = kSpace;
    // mark as ‘wall’ the square we are standing on
 sqi -= xyN;
 *(m + sqi) = kWall;
    // lastTried was successful
    //gLastWasSuccess = true;
    // direction of last success
    //gLastSuccess = lastTried;
 }
}


APossibleExit
// return a direction in which
// there may be an adjacent exit.
// A possible exit must be both an edge and untried.
static dirT
APossibleExit(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m, dirT lastTried)
{
dirT tryD = lastTried + 1; // start here
/* check for edge conditions first */
if (x > 1 && x < xSize - 2)
 if (y > 1 && y < ySize - 2)
 if (z > 1 && z < zSize - 2)
    /* no exits are possibly nearby */
    /* because no edges are nearby */
 return kNoDir; // zero

/* search the adjacent spaces for a possible exit */
/* this could improve a lot */
while (tryD <= kLastDir) {
 const long dx = d2x(tryD);
 const long dy = d2y(tryD);
 const long dz = d2z(tryD);
 if (AtEdge(x+dx, y+dy, z+dz, xSize-1, ySize-1, zSize-1))
 if (myIsUnknown(map(m, x + dx, y + dy, z + dz,
 xSize, xSize * ySize)))
 return tryD;
 tryD++;
 }
tryD = kFirstDir;
while (tryD <= lastTried) {
 const long dx = d2x(tryD);
 const long dy = d2y(tryD);
 const long dz = d2z(tryD);
 if (AtEdge(x+dx, y+dy, z+dz, xSize-1, ySize-1, zSize-1))
 if (myIsUnknown(map(m, x + dx, y + dy, z + dz,
 xSize, xSize * ySize)))
 return tryD;
 tryD++;
 }
return kNoDir; // zero, no possible exit found nearby
}


TotallyUnknown
// returns true if every move leads to an unknown square
// this is only possible at the beginning and after falling
// at least three below our last position.
static Boolean
TotallyUnknown(const long x, const long y, const long z,
 const long xSize, const long xySize, char *m)
{
dirT dir;
/* loop through the directions until we find a known spot */
for (dir = kFirstDir; dir <= kLastDir; dir++) {
 const long dx = d2x(dir);
 const long dy = d2y(dir);
 const long dz = d2z(dir);
 if (!myIsUnknown(map(m, x + dx, y + dy, z + dz,
 xSize, xySize)))
 return false;
 }
return true;
}


MoveTowardsNearWall
// Pick a move that is towards a near wall
// (NOTE: only used when all directions are unknown)
static dirT
MoveTowardsNearWall(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
#pragma unused (m)
long distx = xSize - x - 1; // distance from x==xMax edge
long disty = ySize - y - 1; // distance from y==yMax edge
long distz = zSize - z - 1; // distance from z==zMax edge
// [xyz] is distance from [xyz]==0 edge
long dx, dy, dz;
long xy = xSize * ySize;

if (x < distx) dx = -1;
else if (x == distx) dx = 0;
else dx = 1;
if (y < disty) dy = -1;
else if (y == disty) dy = 0;
else dy = 1;
if (z < distz) dz = -1;
else if (z == distz) dz = 0;
else dz = 1;

return di[dy+1][dz+1][dx+1];
}


Gravity
// Fall until we find a floor below us
// Only use after mapping new knowledge
// (Don’t use during mapping)
static long
Gravity(long i, const char *m, const long xySize)
{
do {i -= xySize;}
 while (kWall != *(m + i));
 
return i + xySize;
}


SearchOneSquare
// Search from this square for an adjacent unknown square
// queueing up moveable squares (including spaces below
// falls) for further research later,
// marking enqueued squares as ‘tried’ (immediately meaning
// ‘not-to-be-queued-for-trying’, later ‘actually-tried’)
// NOTE: while I could mark falls as tried (upward from
// every space) they are rather unlikely to be in the
// search path, so it’s not worth it.  Just re-enact
// gravity each time, and check last square for ‘tried’.
static Boolean
SearchOneSquare(STNPtr startSTN,
 const long xSize, const long xySize, char *m)
{
dirT d;
const long startSquare = startSTN->square;

for (d = kFirstDir; d <= kLastDir; d++) {
 const long sqi = startSquare + offsetD(d,xSize,xySize);
 const char sq = *(m + sqi);
 if (myIsUnknown(sq)) {
 SetBestMove(startSTN, d);
 return true;
 }
 else if (myIsUntriedWalkable(sq)) {
 EnQNewCandidate(startSTN,sqi,d);
 *(m + sqi) = kTriedSpace;
 }
 else if (myIsUntriedFall(sq)) {
 const long bottomSqi = Gravity(sqi,m,xySize);
 const long bottomSq = *(m + bottomSqi);
 if (myIsUntriedWalkable(sq)) {
 EnQNewCandidate(startSTN,bottomSqi,d);
 *(m + bottomSqi) = kTriedSpace;
 }
    //else if (myIsUnknown(bottomSq)) {
    //    BreakToSourceDebugger_(); // should be impossible
    //    return true; //??
    //    }
 else ; //it’s an already tried space, do nothing
 }
 else ; // it’s a wall or already tried space, do nothing
 }
return false;
}


FindNearestUnknown
// Find a move sequence that will lead to an unknown
// square (preferably an edge square?).
static dirT
FindNearestUnknown(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
#pragma unused (zSize)
const long xySize = xSize * ySize;
Boolean found = false;
// make new search tree with square at x,y,z
NewSearchTree();
NewBestMoveList();
gTreeRoot->parent = nil;
gTreeRoot->square = offsetXYZ(x,y,z,xSize,xySize);
gTreeRoot->direction = kNoDir;
*(m + gTreeRoot->square) = kTriedSpace;
// fan out from this one layer at a time
while (!isEmptySearchQ() && !found) {
 STNPtr tryNode = DeQ();
 found = SearchOneSquare(tryNode, xSize, xySize, m);
    //FreeSTN(tryNode);
 }
DisposeSearchTree(m);
// found move(list) or failed
return found;
}


CalcBestMove
// Calculate the best move to try
// return true if we have found an exit or are at wit’s end
static dirT
CalcBestMove(const long x, const long y, const long z,
 const long xSize, const long ySize, const long zSize,
 char *m)
{
static dirT lastTried = kNoDir;
dirT d;

if (!isEmptyMoveList()) { // we have a pre-made list of moves

 

Community Search:
MacTech Search:

Software Updates via MacUpdate

Chromium 75.0.3770.142 - Fast and stable...
Chromium is an open-source browser project that aims to build a safer, faster, and more stable way for all Internet users to experience the web. Version 75.0.3770.142: Release notes were... Read more
Viber 11.1.0 - Send messages and make fr...
Viber lets you send free messages and make free calls to other Viber users, on any device and network, in any country! Viber syncs your contacts, messages and call history with your mobile device, so... Read more
Wireshark 3.0.3 - Network protocol analy...
Wireshark is one of the world's foremost network protocol analyzers, and is the standard in many parts of the industry. It is the continuation of a project that started in 1998. Hundreds of... Read more
DEVONthink Pro 3.0beta4 - Knowledge base...
DEVONthink Pro is your essential assistant for today's world, where almost everything is digital. From shopping receipts to important research papers, your life often fills your hard drive in the... Read more
Adobe Creative Cloud 4.9.0.512 - Access...
Adobe Creative Cloud costs $20.99/month for a single app, or $52.99/month for the entire suite. Introducing Adobe Creative Cloud desktop applications, including Adobe Photoshop CC and Illustrator CC... Read more
SketchUp 19.1.174 - Create 3D design con...
SketchUp is an easy-to-learn 3D modeling program that enables you to explore the world in 3D. With just a few simple tools, you can create 3D models of houses, sheds, decks, home additions,... Read more
ClamXav 3.0.12 - Virus checker based on...
ClamXav is a popular virus checker for OS X. Time to take control ClamXAV keeps threats at bay and puts you firmly in charge of your Mac’s security. Scan a specific file or your entire hard drive.... Read more
BetterTouchTool 3.151 - Customize multi-...
BetterTouchTool adds many new, fully customizable gestures to the Magic Mouse, Multi-Touch MacBook trackpad, and Magic Trackpad. These gestures are customizable: Magic Mouse: Pinch in / out (zoom)... Read more
FontExplorer X Pro 6.0.9 - Font manageme...
FontExplorer X Pro is optimized for professional use; it's the solution that gives you the power you need to manage all your fonts. Now you can more easily manage, activate and organize your... Read more
Dropbox 77.4.131 - Cloud backup and sync...
Dropbox is an application that creates a special Finder folder that automatically syncs online and between your computers. It allows you to both backup files and keeps them up-to-date between systems... Read more

Latest Forum Discussions

See All

Upcoming visual novel Arranged shines a...
If you’re in the market for a new type of visual novel designed to inform and make you think deeply about its subject matter, then Arranged by Kabuk Games could be exactly what you’re looking for. It’s a wholly unique take on marital traditions in... | Read more »
TEPPEN guide - The three best decks in T...
TEPPEN’s unique take on the collectible card game genre is exciting. It’s just over a week old, but that isn’t stopping lots of folks from speculating about the long-term viability of the game, as well as changes and additions that will happen over... | Read more »
Intergalactic puzzler Silly Memory serve...
Recently released matching puzzler Silly Memory is helping its fans with their intergalactic journeys this month with some very special offers on in-app purchases. In case you missed it, Silly Memory is the debut title of French based indie... | Read more »
TEPPEN guide - Tips and tricks for new p...
TEPPEN is a wild game that nobody asked for, but I’m sure glad it exists. Who would’ve thought that a CCG featuring Capcom characters could be so cool and weird? In case you’re not completely sure what TEPPEN is, make sure to check out our review... | Read more »
Dr. Mario World guide - Other games that...
We now live in a post-Dr. Mario World world, and I gotta say, things don’t feel too different. Nintendo continues to squirt out bad games on phones, causing all but the most stalwart fans of mobile games to question why they even bother... | Read more »
Strategy RPG Brown Dust introduces its b...
Epic turn-based RPG Brown Dust is set to turn 500 days old next week, and to celebrate, Neowiz has just unveiled its biggest and most exciting update yet, offering a host of new rewards, increased gacha rates, and a brand new feature that will... | Read more »
Dr. Mario World is yet another disappoin...
As soon as I booted up Dr. Mario World, I knew I wasn’t going to have fun with it. Nintendo’s record on phones thus far has been pretty spotty, with things trending downward as of late. [Read more] | Read more »
Retro Space Shooter P.3 is now available...
Shoot-em-ups tend to be a dime a dozen on the App Store, but every so often you come across one gem that aims to shake up the genre in a unique way. Developer Devjgame’s P.3 is the latest game seeking to do so this, working as a love letter to the... | Read more »
Void Tyrant guide - Guildins guide
I’ve still been putting a lot of time into Void Tyrant since it officially released last week, and it’s surprising how much stuff there is to uncover in such a simple-looking game. Just toray, I finished spending my Guildins on all available... | Read more »
Tactical RPG Brown Dust celebrates the s...
Neowiz is set to celebrate the summer by launching a 2-month long festival in its smash-hit RPG Brown Dust. The event kicks off today, and it’s divided into 4 parts, each of which will last two weeks. Brown Dust is all about collecting, upgrading,... | Read more »

Price Scanner via MacPrices.net

Verizon is offering a 50% discount on iPhone...
Verizon is offering 50% discounts on Apple iPhone 8 and iPhone 8 Plus models though July 24th, plus save 50% on activation fees. New line required. The fine print: “New device payment & new... Read more
Get a new 21″ iMac for under $1000 today at t...
B&H Photo has new 21″ Apple iMacs on sale for up to $100 off MSRP with models available starting at $999. These are the same iMacs offered by Apple in their retail and online stores. Shipping is... Read more
Clearance 2017 15″ 2.8GHz Touch Bar MacBook P...
Apple has Certified Refurbished 2017 15″ 2.8GHz Space Gray Touch Bar MacBook Pros available for $1809. Apple’s refurbished price is currently the lowest available for a 15″ MacBook Pro. An standard... Read more
Clearance 12″ 1.2GHz MacBook on sale for $899...
Focus Camera has clearance 12″ 1.2GHz Space Gray MacBooks available for $899.99 shipped. That’s $400 off Apple’s original MSRP. Focus charges sales tax for NY & NJ residents only. Read more
Get a new 2019 13″ 2.4GHz 4-Core MacBook Pro...
B&H Photo has new 2019 13″ 2.4GHz MacBook Pros on sale for up to $150 off Apple’s MSRP. Overnight shipping is free to many addresses in the US: – 2019 13″ 2.4GHz/256GB 6-Core MacBook Pro Silver... Read more
AirPods with Wireless Charging Case now on sa...
Amazon has extended their Prime Day savings on Apple AirPods by offering AirPods with the Wireless Charging case for $169.99. That’s $30 off Apple’s MSRP, and it’s the cheapest price available for... Read more
New 2019 15″ MacBook Pros on sale for $200 of...
B&H Photo has the new 2019 15″ 6-Core and 8-Core MacBook Pros on sale for $200 off Apple’s MSRP. Overnight shipping is free to many addresses in the US: – 2019 15″ 2.6GHz 6-Core MacBook Pro Space... Read more
Amazon drops prices, now offers clearance 13″...
Amazon has new dropped prices on clearance 13″ 2.3GHz Dual-Core non-Touch Bar MacBook Pros by $200 off Apple’s original MSRP, with prices now available starting at $1099. Shipping is free. Be sure to... Read more
2018 15″ MacBook Pros now on sale for $500 of...
Amazon has dropped prices on select clearance 2018 15″ 6-Core MacBook Pros to $500 off Apple’s original MSRP. Prices now start at $1899 shipped: – 2018 15″ 2.2GHz Touch Bar MacBook Pro Silver: $1899.... Read more
Price drop! Clearance 12″ 1.2GHz Silver MacBo...
Amazon has dropped their price on the recently-discontinued 12″ 1.2GHz Silver MacBook to $849.99 shipped. That’s $450 off Apple’s original MSRP for this model, and it’s the cheapest price available... Read more

Jobs Board

Best Buy *Apple* Computing Master - Best Bu...
**696259BR** **Job Title:** Best Buy Apple Computing Master **Job Category:** Store Associates **Location Number:** 001076-Temecula-Store **Job Description:** The Read more
Business Development Manager, *Apple* Globa...
Business Development Manager, Apple Global Tampa, FL, US Requisition Number:73805 As a Global Apple Business Development Manager at Insight, you proactively Read more
*Apple* Systems Architect/Engineer, Vice Pre...
…its vision to be the world's most trusted financial group. **Summary:** Apple Systems Architect/Engineer with strong knowledge of products and services related to Read more
*Apple* IOS Systems Engineer - Randstad (Uni...
Apple IOS Systems Engineer **job details:** + location:Irvine, CA + salary:$45 - $55 per hour + date posted:Tuesday, July 16, 2019 + job type:Temp to Perm + Read more
Business Development Manager, *Apple* Globa...
Business Development Manager, Apple Global Tampa, FL, US Requisition Number:73805 As a Global Apple Business Development Manager at Insight, you proactively Read more
All contents are Copyright 1984-2011 by Xplain Corporation. All rights reserved. Theme designed by Icreon.